ID: 1005883092_1005883107

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1005883092 1005883107
Species Human (GRCh38) Human (GRCh38)
Location 6:30075000-30075022 6:30075051-30075073
Sequence CCTCCTCCCCTGTGGACCAAGTG CCTCTCACCTTGAGGACCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!