ID: 1005883799_1005883806

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1005883799 1005883806
Species Human (GRCh38) Human (GRCh38)
Location 6:30079603-30079625 6:30079622-30079644
Sequence CCAAATTTTAAAGGTGCAGTGAC TGACGGGGGAAGAGTGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 57, 4: 579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!