ID: 1005894216_1005894227

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005894216 1005894227
Species Human (GRCh38) Human (GRCh38)
Location 6:30164057-30164079 6:30164102-30164124
Sequence CCCTACCGGGTAAGAAGTGTAGC CAGGATGATGTCCTGTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36} {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!