ID: 1005953504_1005953513

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1005953504 1005953513
Species Human (GRCh38) Human (GRCh38)
Location 6:30647805-30647827 6:30647836-30647858
Sequence CCCAGCAGAGACGGCGCCTCTAG CGGGGACCGAGGTACCCGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!