ID: 1005955419_1005955428

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1005955419 1005955428
Species Human (GRCh38) Human (GRCh38)
Location 6:30660049-30660071 6:30660091-30660113
Sequence CCACAGGAAACCTGCGTCCGGGG CATCAAAGAAGGTGGAAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86} {0: 1, 1: 1, 2: 2, 3: 59, 4: 619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!