ID: 1005958165_1005958176

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1005958165 1005958176
Species Human (GRCh38) Human (GRCh38)
Location 6:30679104-30679126 6:30679135-30679157
Sequence CCCTCCTCTCTCCTGGACCACAG CTGACAGCAGGGGGCGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 622} {0: 1, 1: 0, 2: 4, 3: 29, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!