ID: 1005961801_1005961808

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1005961801 1005961808
Species Human (GRCh38) Human (GRCh38)
Location 6:30699020-30699042 6:30699067-30699089
Sequence CCTCGTCTCTACCAAAAATACAA ACCTATGGTCCCAGCTACTTGGG
Strand - +
Off-target summary {0: 2741, 1: 108577, 2: 229425, 3: 155126, 4: 84925} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!