ID: 1005966569_1005966573

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1005966569 1005966573
Species Human (GRCh38) Human (GRCh38)
Location 6:30730860-30730882 6:30730877-30730899
Sequence CCATCTTGGGGTGCCTAGGTGGC GGTGGCAAGTGAGCTAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112} {0: 1, 1: 0, 2: 0, 3: 20, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!