ID: 1005990271_1005990284

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1005990271 1005990284
Species Human (GRCh38) Human (GRCh38)
Location 6:30897961-30897983 6:30897998-30898020
Sequence CCTCCACATGGGGAGCCAGAGTG GTGGGCTCTCTCTCCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 22, 4: 258} {0: 1, 1: 0, 2: 4, 3: 50, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!