ID: 1005992814_1005992830

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1005992814 1005992830
Species Human (GRCh38) Human (GRCh38)
Location 6:30914125-30914147 6:30914176-30914198
Sequence CCCCGTGGGGTTTGCCTTCGCGG TGGACCGGTAGGGAGAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33} {0: 1, 1: 0, 2: 2, 3: 12, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!