ID: 1005992822_1005992838

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1005992822 1005992838
Species Human (GRCh38) Human (GRCh38)
Location 6:30914158-30914180 6:30914211-30914233
Sequence CCTCTGGTCTACAGCCTTTGGAC TGCTGCGCATGCGCCGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 177} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!