ID: 1005992832_1005992837

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1005992832 1005992837
Species Human (GRCh38) Human (GRCh38)
Location 6:30914180-30914202 6:30914210-30914232
Sequence CCGGTAGGGAGAGGGTGGGGCCA CTGCTGCGCATGCGCCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 461} {0: 1, 1: 0, 2: 6, 3: 14, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!