ID: 1005994658_1005994672

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1005994658 1005994672
Species Human (GRCh38) Human (GRCh38)
Location 6:30923928-30923950 6:30923955-30923977
Sequence CCCCGCTCCACTGCCACCCCAGA CTCCTTTAGCAGGTTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 499} {0: 1, 1: 0, 2: 1, 3: 30, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!