ID: 1005999731_1005999744

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1005999731 1005999744
Species Human (GRCh38) Human (GRCh38)
Location 6:30955651-30955673 6:30955695-30955717
Sequence CCGAGGGCAGGAGGCTGCCGGGG CGGAGTCGCAGCGGGGGCTCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!