ID: 1006003791_1006003798

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006003791 1006003798
Species Human (GRCh38) Human (GRCh38)
Location 6:30987089-30987111 6:30987131-30987153
Sequence CCAGTACGACCTCCAGTGGGGCC ACTCCAGCACAACCTCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 7, 3: 10, 4: 60} {0: 2, 1: 5, 2: 7, 3: 12, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!