|
Left Crispr |
Right Crispr |
| Crispr ID |
1006024203 |
1006024209 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:31137106-31137128
|
6:31137159-31137181
|
| Sequence |
CCATTGCACTCCAGCCTGGGCAT |
AGAAAAAGAAGAAAGAGGCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 227, 1: 38605, 2: 113477, 3: 184493, 4: 231470} |
{0: 1, 1: 8, 2: 140, 3: 1117, 4: 7333} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|