ID: 1006024204_1006024208

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006024204 1006024208
Species Human (GRCh38) Human (GRCh38)
Location 6:31137116-31137138 6:31137158-31137180
Sequence CCAGCCTGGGCATAGAGTGAGAC AAGAAAAAGAAGAAAGAGGCCGG
Strand - +
Off-target summary {0: 9, 1: 140, 2: 838, 3: 7218, 4: 13193} {0: 1, 1: 7, 2: 104, 3: 1319, 4: 9000}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!