|
Left Crispr |
Right Crispr |
Crispr ID |
1006024206 |
1006024210 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:31137140-31137162
|
6:31137167-31137189
|
Sequence |
CCGTCTAAAAAAAAAAGAAAGAA |
AAGAAAGAGGCCGGGCGCTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 33, 1: 664, 2: 8439, 3: 103037, 4: 93910} |
{0: 2, 1: 40, 2: 377, 3: 2745, 4: 10929} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|