ID: 1006030193_1006030206

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1006030193 1006030206
Species Human (GRCh38) Human (GRCh38)
Location 6:31172179-31172201 6:31172222-31172244
Sequence CCCTCTGCAATCCCCTCAAAGAC AGGGCCCCCCACAGGGACCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 380} {0: 1, 1: 0, 2: 3, 3: 33, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!