ID: 1006054944_1006054950

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1006054944 1006054950
Species Human (GRCh38) Human (GRCh38)
Location 6:31377414-31377436 6:31377427-31377449
Sequence CCCTGGCCTGTACCCTAGTGCTT CCTAGTGCTTTGTATGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131} {0: 1, 1: 0, 2: 15, 3: 289, 4: 2918}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!