ID: 1006057397_1006057407

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1006057397 1006057407
Species Human (GRCh38) Human (GRCh38)
Location 6:31395696-31395718 6:31395722-31395744
Sequence CCAGAGCCAGCGCTGAGGGAGAG GGACTCAGGGGCGGGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!