ID: 1006059796_1006059808

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006059796 1006059808
Species Human (GRCh38) Human (GRCh38)
Location 6:31411576-31411598 6:31411612-31411634
Sequence CCCTCCGACAGAATCCTGAGCCT GGCAGGAGAGGAAGCCTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 109} {0: 1, 1: 2, 2: 2, 3: 56, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!