ID: 1006059802_1006059809

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006059802 1006059809
Species Human (GRCh38) Human (GRCh38)
Location 6:31411590-31411612 6:31411617-31411639
Sequence CCTGAGCCTGTGGTGGGTGTCAG GAGAGGAAGCCTTCAGGGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!