ID: 1006085134_1006085140

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1006085134 1006085140
Species Human (GRCh38) Human (GRCh38)
Location 6:31589839-31589861 6:31589881-31589903
Sequence CCACTCTGCACACGTAGATGCTG CCCGGATGTGCAGCTCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117} {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!