ID: 1006085134_1006085143

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006085134 1006085143
Species Human (GRCh38) Human (GRCh38)
Location 6:31589839-31589861 6:31589890-31589912
Sequence CCACTCTGCACACGTAGATGCTG GCAGCTCAGCCTGGTGGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117} {0: 1, 1: 1, 2: 3, 3: 55, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!