ID: 1006095340_1006095353

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1006095340 1006095353
Species Human (GRCh38) Human (GRCh38)
Location 6:31652697-31652719 6:31652743-31652765
Sequence CCCACCCCCTCCCCCCTCTGGCG TGAGCGCTAGAAGATTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 768} {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!