ID: 1006114172_1006114184

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1006114172 1006114184
Species Human (GRCh38) Human (GRCh38)
Location 6:31766448-31766470 6:31766492-31766514
Sequence CCCCTGGCGTCTCACCTCCAGAA GCTGAGGGGCAGCCCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 175} {0: 1, 1: 1, 2: 1, 3: 56, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!