ID: 1006114178_1006114184

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1006114178 1006114184
Species Human (GRCh38) Human (GRCh38)
Location 6:31766462-31766484 6:31766492-31766514
Sequence CCTCCAGAAGGACAGGGACTACA GCTGAGGGGCAGCCCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 113, 4: 2787} {0: 1, 1: 1, 2: 1, 3: 56, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!