ID: 1006115952_1006115960

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006115952 1006115960
Species Human (GRCh38) Human (GRCh38)
Location 6:31776350-31776372 6:31776369-31776391
Sequence CCCACAAAGGAGGGACAGTCCCG CCCGGACCTTTCTAAGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!