ID: 1006116843_1006116853

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006116843 1006116853
Species Human (GRCh38) Human (GRCh38)
Location 6:31780146-31780168 6:31780173-31780195
Sequence CCTCCGGGCTTGGGGAGAGAGGG TCAGCCGGCGGGCCAGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 406} {0: 1, 1: 0, 2: 2, 3: 16, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!