ID: 1006119344_1006119352

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006119344 1006119352
Species Human (GRCh38) Human (GRCh38)
Location 6:31794954-31794976 6:31794968-31794990
Sequence CCCTGGGCCCCCCAGGCCTGCTG GGCCTGCTGGCCACAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 599} {0: 1, 1: 0, 2: 2, 3: 45, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!