ID: 1006148375_1006148384

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006148375 1006148384
Species Human (GRCh38) Human (GRCh38)
Location 6:31972446-31972468 6:31972481-31972503
Sequence CCTTTGGAGTTAAGAGGCGGCGG GTGGAGTCGGATCCTCTTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
12 6:31972446-31972468 CCTTTGGAGTTAAGAGGCGGCGG - 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG +