ID: 1006151102_1006151115

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1006151102 1006151115
Species Human (GRCh38) Human (GRCh38)
Location 6:31990485-31990507 6:31990529-31990551
Sequence CCCCACGTTGGGCGCCAGAATGT CCTGTAGGGTACCTGAAGTCTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 4, 3: 8, 4: 82} {0: 3, 1: 4, 2: 10, 3: 28, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!