ID: 1006155047_1006155054

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006155047 1006155054
Species Human (GRCh38) Human (GRCh38)
Location 6:32009370-32009392 6:32009397-32009419
Sequence CCCCAGCCCGCAGGTCCACGCGC AGTAGTCACCTGCCTGTGTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 11, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!