ID: 1006155047_1006155060

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006155047 1006155060
Species Human (GRCh38) Human (GRCh38)
Location 6:32009370-32009392 6:32009421-32009443
Sequence CCCCAGCCCGCAGGTCCACGCGC TGTGCAGGGCCTCATTGCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!