ID: 1006161585_1006161592

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1006161585 1006161592
Species Human (GRCh38) Human (GRCh38)
Location 6:32042904-32042926 6:32042919-32042941
Sequence CCTGGAATCACCCAGGGAGGGGA GGAGGGGAGTTGGGTCAGTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 241} {0: 2, 1: 0, 2: 4, 3: 42, 4: 498}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!