ID: 1006163742_1006163747

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006163742 1006163747
Species Human (GRCh38) Human (GRCh38)
Location 6:32052813-32052835 6:32052832-32052854
Sequence CCGTCCCTGTCCTTGTACTGCAC GCACAGTGAAGGAGTCGAAGCGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 4, 3: 27, 4: 308} {0: 1, 1: 4, 2: 3, 3: 12, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!