ID: 1006166981_1006166997

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1006166981 1006166997
Species Human (GRCh38) Human (GRCh38)
Location 6:32070905-32070927 6:32070953-32070975
Sequence CCCTTTCTTATTCTGCACCGGCT TGGGCCTGGTGAAGGAGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!