ID: 1006172930_1006172934

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1006172930 1006172934
Species Human (GRCh38) Human (GRCh38)
Location 6:32105636-32105658 6:32105662-32105684
Sequence CCACGGACAGTGTCTGGGACTGG TTGGTTAGACACAGCCACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!