ID: 1006175661_1006175667

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1006175661 1006175667
Species Human (GRCh38) Human (GRCh38)
Location 6:32119934-32119956 6:32119963-32119985
Sequence CCTGGATGAGGACAACTGGGGAC GCAAGTGAGCAGAGGTCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174} {0: 1, 1: 0, 2: 2, 3: 29, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!