ID: 1006180361_1006180370

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1006180361 1006180370
Species Human (GRCh38) Human (GRCh38)
Location 6:32150459-32150481 6:32150481-32150503
Sequence CCCACAGTCCCCGCGTGCGTGGG GCACCACGAAGCCAGGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 3, 3: 20, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!