ID: 1006185357_1006185361

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1006185357 1006185361
Species Human (GRCh38) Human (GRCh38)
Location 6:32178551-32178573 6:32178583-32178605
Sequence CCAAATCGCGAGCGGGGCGGGGC CTTCGAATGTAATATATGTTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 48} {0: 2, 1: 0, 2: 1, 3: 7, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!