ID: 1006190425_1006190428

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006190425 1006190428
Species Human (GRCh38) Human (GRCh38)
Location 6:32204233-32204255 6:32204247-32204269
Sequence CCACGTCTCCCTCACAGCGTAGC CAGCGTAGCCCCACAAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!