ID: 1006205575_1006205583

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1006205575 1006205583
Species Human (GRCh38) Human (GRCh38)
Location 6:32338821-32338843 6:32338843-32338865
Sequence CCCCAGTTTATTAAGATAAGAAT TAGGGAATAAACAAGGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 362} {0: 1, 1: 0, 2: 0, 3: 29, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!