ID: 1006257938_1006257948

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1006257938 1006257948
Species Human (GRCh38) Human (GRCh38)
Location 6:32845804-32845826 6:32845838-32845860
Sequence CCGTCAGAGCCGGGGACTACCCT GACACCTGTGTTTCCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113} {0: 1, 1: 1, 2: 3, 3: 30, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!