ID: 1006258883_1006258887

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1006258883 1006258887
Species Human (GRCh38) Human (GRCh38)
Location 6:32852588-32852610 6:32852601-32852623
Sequence CCCTCACCATTATCCTGGAGGGC CCTGGAGGGCATCAGCAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 192} {0: 1, 1: 0, 2: 0, 3: 18, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!