ID: 1006259816_1006259821

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1006259816 1006259821
Species Human (GRCh38) Human (GRCh38)
Location 6:32858400-32858422 6:32858426-32858448
Sequence CCTTTTGCCATTGGTGGCTCCGG CACCTTTATCTATGGTTATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115} {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!