ID: 1006261343_1006261348

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006261343 1006261348
Species Human (GRCh38) Human (GRCh38)
Location 6:32874151-32874173 6:32874182-32874204
Sequence CCATGGTGCATATGTACATTTTC GTCTGTCATTGATGGGCAGTTGG
Strand - +
Off-target summary No data {0: 2, 1: 231, 2: 3980, 3: 8555, 4: 17408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!