ID: 1006268942_1006268948

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1006268942 1006268948
Species Human (GRCh38) Human (GRCh38)
Location 6:32949325-32949347 6:32949359-32949381
Sequence CCAGCACACCCAGGCCAAAGGCC CACATTCTCCAGCAGATCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 388} {0: 1, 1: 0, 2: 3, 3: 14, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!