ID: 1006301629_1006301635

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1006301629 1006301635
Species Human (GRCh38) Human (GRCh38)
Location 6:33196493-33196515 6:33196518-33196540
Sequence CCACAGCAAGCTCTGCCTCCAGG CCTGTCCACAGGCATCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 143, 3: 1234, 4: 2893} {0: 1, 1: 0, 2: 3, 3: 28, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!